>Corresponding Author : Michel Leclerc
>Article Type : Research Article
>Volume : 1 | Issue : 1
>Received Date : 15 November, 2021
>Accepted Date : 23 November, 2021
>Published Date : 26 November, 2021
>DOI : https://doi.org/10.54289/JVVD2100105
>Citation : Leclerc M (2021) The Asterias Rubens Sea Star Igkappa Gene when Compared to Marthasterias Glacialis Sea Star Genome (Echinodermata). J Virol Viral Dis 1(1). doi https://doi.org/10.54289/JVVD2100105
>Copyright : © 2021 Leclerc M. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Research Article | Open Access
Immunology of Invertebrates, Department of Biology -Biochemistry, Orléans University, France
*Corresponding author: Michel Leclerc, Immunology of Invertebrates, Department of Biology -Biochemistry, Orléans University, France
Abstract
The sea star IGKappa gene was cloned in 2014 by the use of primers. It was compared in the present work to Marthasterias glacialis sea star genome. A high identity was found with this last one.
Introduction:
The sequence of the sea star Asterias rubens IGKappa gene was described by our team, in 2014 [1]. Since we have tried to find homologies between this gene and genes from another Asterid: Marthasterias glacialis
We report, in the precedent paper, results obtained with these last ones by the use of blasts against human genes [2, 3].
The sequence of the sea star IGKappa gene is the following [1]:
5’GGATCCGGAGGAATGCGTGGCAACATGGCGTCTCTATGGATGTTCTTCTTTGTCGTGGGGATAACTTTACAACGGAGTTTGGCGATTTACACGTTTCGCGAGCAACCGTCGGACACTAGCGCGTTGCAGGGGAGCACAGTGGTGCTTCACTGCTCCGTTGAGCAGTACATAAACACCACGGCCATCGTTTGGTGGAGCCGTGACTCGGTCATCAGCCACAACAAAGACCTGAAACTGTCCAGTCTAAACACCGACCAGCTCCAAAGGTACTCGATTTCAGGCGACGCATCTCGGGGGGAATTCAACCTTAAAATAGTGAACTTTACCGCCACAGACGCCGCCAGTTACCGCTGTCAGATGTAAGAATTC3’
Results:
Results are summarized in table below:
Table 1: Blastn original sequence: Blastn results
Molecule type: dna
Query length: 357
| Description | Scientific name | Max score | Total score | Query cover | E. Value | Per. Ident | Acc Len | Accession |
|---|---|---|---|---|---|---|---|---|
| Predicted: Asterias Rubens Uncharacterized Loc117296905 (Loc117296905), mRNA | Asterias rubens | 634 | 634 | 97% | 2e-177 | 99.43% | 4538 | XM_033780010.1 |
| Asterias Rubens Genome Assembly, Chromosome: 11 | Asterias rubens | 634 | 634 | 97% | 2e-177 | 99.43% | 18069988 | LR699102.1 |
| Marthasterias Glacialis Genome Assembly, Chromosome: 6 | Marthasterias glacialis | 329 | 329 | 95% | 9e-86 | 84.16% | 28777708 | OU452224.1 |
The graphic summary gives the opportunity to see the top3 Blast Hits:
As for Alignements we find a high identity nearly 100% as shown below:
99% Identities (347/349bp) with Predicted: Asterias Rubens Uncharacterized Loc117296905 (Loc117296905), mRNA
Reference Sequence: XM_033780010.1
Length: 4539
Aligment: 1546 - 1894
Conclusion
We retain from this bioinformatic analysis, a high identity between the Asterias rubens sea star IGKappa gene with the sea star Marthasterias glacialis genome. Those genes, neverthelessseem less evolved that the Ophuirid IGKappa gene we discovered 1 month ago [4] in terms of Immune functions.Sea stars belong to Asterid class. They are Echinodermasta like Ophuirids.
References
- 1. Vincent N, et al. (2014) A new gene in A. rubens: A sea star Ig kappa gene. Meta Gene 2: 320-322. [Ref.]
- 2. Marchler-Bauer A, et al. (2017) CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acid Res 45(D): 200-203. [PubMed.]
- 3. Marchler-Bauer A, et al. (2011) CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acid Res 39(D): 225-229. [PubMed.]
- 4. Leclerc M (2021) E IG V-L K appa Expression from Sea Star Igkappa Gene. J Clin Class Immunol. 1(1). [Ref.]
